HLA CHT Practice Exam Questions And Answers

Blood specimens known to carry pathogens are packaged the same as routine specimens..... true or false - ANS True When performing a blood draw, what is not part of the routine procedure? Change gloves in between patients Informing patient of HIV status Wear a lab coat or gown - ANS Informing patient of HIV status What is a fire assembly area? - ANS A safe place to meet during a fire, that is predetermined by employer Reagent x arrives in the lab, What action is the best action to do? - ANS Periodically QC the reagent and develop a QA analysis of its performance to derive an appropriate expiration date You have a patient that does not want to be listed. What should you do with all of the reports, typing, paperwork etc? Some is online (LIS) and others are on paper. - ANS Keep said paperwork for two years as long as the LIS is backed up regularly and paper storage is secure A 100ul stock solution of DNA is 160 ug/ml. What final volume should you dilute the stock, to achieve a working concentration of 40ug/ml? - ANS 400ul You would use the formula C1V1=C2V2 100x160= /40=400 C Solution three combines all of solution one and two. Solution one consists of 2.0ml of cells at a concentration 5x10 to the 6th, Solution two consists of 7.0ml of cells at a concentration of 3x10 to the 6th. What is the cell concentration of solution 3. - ANS 3.4 x 10 to the 6th cells/ml 2.0x5=10 7.0x3=21 31cells/ml divided by total volume of solution one and two so 9mls=3.4cells/ml What is equivalent to 2N H2SO4? The molecular weight of H2SO4 is 98g/mol - ANS 9.8g H2SO4 om 100ml of H2O 100g of NaCl (NA=22.99g/mol Cl=35.43g/mol) is dissolved in 1500ml of water, what is the molarity? - ANS 1.14m Approximately ho many grams of sodium chloride are required per 100ml of water? - ANS 0.85 Would you be able to use blood that was collected in EDTA for serology? - ANS No What organ yields the most B cells? - ANS Spleen How should whole blood specimens drawn into ACD tubes be stored? - ANS Room temperature The absolute A260 and A280 values and their ratio for a DNA sample provide what information? a. Length and concentration b. Free 3' ends and length c. Concentration and RNA/Protein contamination d. Concentration and percent degraded - ANS Concentration and RNA/Protein contamination Which of the following samples can be used for determining a patients class I HLA type with a DNA based method? A. 5ml ficoll separated PBLs in PBS B. 2ml peripheral blood in EDTA C. 3ml B cells in PBS, isolated by negative selection magnetic beads D A and B E All of the above - ANS E Which of the folllowing samples would be least preferred for CDC/PRA testing? A Plain red top tube B Serum separator tube C Frozen serum D ACD yellow top tube - ANS D Thrombin is used for what? - ANS Clotting anti-coagulated plasma What treatment causes the chelation of magnesium and calcium? - ANS EDTA What is the purpose of pronasing cells for a flow crossmatch? - ANS To remove CD20 from the cell surface What does C1V1=C2V2 mean? - ANS C1=Concentration of the stock V1=volume to be removed from the concentrated stock solution C2=Final concentration of the diluted solution V2=Final volume of the diluted solution Dead cells stained with AO/EB appear orange because a. Ethidium bromide prevents AO binding b. AO leaks out of the dead cell, leaving only ethidium bromide c. Ethidium bromide fluoresces much more strongly than AO d. AO binds only RNA, which washes away when the cell is dead e. Dead cells are actually orange. - ANS C Ficoll separates lymphocytes based on what? - ANS Density What effect do heterophile antibodies in the complement have on the AHG-CDC assay? A) CDC assay complement does not contain appreciable amounts of heterophile antibodies B) Enhances the effectiveness of the complement C) many false negative reactions D) Decreased CYNAP effect - ANS C What is the usual source of complement used in CDC crossmatch assay? - ANS Rabbit Which of the following is true about storing flourescent reagents including monoclonal antibodies and micro array beads? A) Ensure reagent is kept frozen as much as possible, so replace vial in freezer between runs B) Ensure reagent is kept in the dark to avoid photobleaching, so use light blocking vials and store them in a closed box C) Ensure reagent is not frozen, so leave vials at 4c or on the beach D) Ensure reagent receives sufficient light to activate fluorescence, so leave vial on the counter with the lights for at least 1 hour - ANS B The usual final concentration of DMSO for freezing cells? - ANS 10 percent A short DNA oligonucleotide used for PCR-SSP amplification is what? A) Probe B) Amplicon C) Polymerase D) Primer E) Okazaki fragment - ANS Primer Which of the listed probes with have the highest TM? A) AACTAGTTA B) CTATGGATCGTTGGCTACTCT C) GTAGATTATATTACTCTAGCA D) AACTAGTTC E) ATATATATAT - ANS C...Look for the most G/Cs Primers and probes bind to their DNA targets through a process known as a) High stringency b) Hydrogen bonding c) Covalent bonding d) Primer dimerism e) Low Stringency - ANS B Hydrogen Bonding Which is true of the 3' and/or 5' ends of an oligonucleotide primer? a) The 3' and 5' ends always have purines b) The 3' and 5' ends always have pyrimidines c) The 3' and 5' ends may both serve as an template for Taq elongation d) The 3' end may accept GTP in the presence of a DNA polymerase e) The 5' end is the critical portion for determining the specificity of a primer - ANS E The 5' is the critical portion for determining the specificity of a primer What is true of the DNA polymerase used in PCR? A) The enzyme should only incorporate dideoxy nucleotides B) The enzyme should have a low fidelity C) The enzyme should denature at 37f D) The enzyme should be heat resistant - ANS D Heat resistant The structural component of a nucleotide is what? A) A, G, C, U, T B) A, C, G, U C) Base, Sugar, Phosphate D) Base, Acid, Neutral - ANS C....Base, Sugar, Phosphate What is true regarding dUTP? A) Nucleotide in unamplified DNA B) Similar to dCTP in base pairing C) RNA Sugar D) dUTP can be substituted for dTTP in PCR - ANS D.....dUTP can be substituted for dTTP in PCR