BIO 235 - Final Exam Study Guide
CORRECT 100%
The Central Dogma of molecular biology states that, in cells, biological information
_______.
A. Can be transmitted either from DNA to RNA or from RNA to DNA
B. Moves from DNA to RNA to protein
C. Moves from protein to RNA to DNA
D. Moves from DNA to RNA only if encoded by certain viruses
E. Moves from protein to RNA only if encoded by certain viruses - ANSWER B
What is the exception to the Central Dogma rule? - ANSWER RETROVIRUSES
(process goes from RNA to DNA using reverse transcriptase enzymes)
What do retroviruses have that allows them to go from RNA to DNA? - ANSWER
Reverse transcriptase enzymes
What category of transposable elements use an RNA copy of their genome in the
process of transposition?
A. Cut-and-paste transposons
B. Composite bacterial transposons
C. Bacterial insertion sequences
D. Retrotransposons
E. Multiple drug resistance plasmids - ANSWER D
Copy-and-paste transposons a.k.a. replicative transposition - ANSWER A new copy of
the transposable element is introduced at a new site while the old copy remains behind
at the original site (so the number of copies of the transposable element increases)
Transposons a.k.a. transposable elements - ANSWER Sequences that can move about
in the genome and are often a cause of mutations
Are direct repeats part of a transposon? - ANSWER NO
Are inverted repeats part of a transposon? - ANSWER YES
Transposition - ANSWER The movement of a transposon
Cut-and-paste transposons a.k.a. nonreplicative transposition - ANSWER Transposable
element excises from the old site and inserts at a new site WITHOUT any increase in
the number of its copies
Retrotransposons - ANSWER Elements that transpose through an RNA intermediate
,Mutagenic compounds that fit and "get stuck" between nucleotides of DNA molecules
are called ________, whereas mutagenic compounds that cause the covalent
attachment of a methyl or an ethyl group to bases of DNA are called ______.
A. De-aminating agents; reactive oxygen molecules
B. Oxidizing agents; glycosylases
C. Intercalating agents; alkylating agents
D. Hydrolases; base analogs
E. Catalytic converters; organic solvents - ANSWER C
Base analogs - ANSWER Chemicals with structures similar to that of any of the four
standard bases of DNA (DNA polymerase canNOT distinguish these analogs from the
standard bases)
Alkylating agents - ANSWER Chemicals that donate alkyl groups like methyl and ethyl
groups
Deamination - ANSWER Removing an amino group
Intercalating agents - ANSWER Produce mutations by sandwiching themselves
(intercalating) between adjacent bases in DNA, distorting the three-dimensional
structure of the helix and causing single-nucleotide insertions and deletions in
replication
What form of radiation causes double-strand breaks in DNA? - ANSWER X-rays
(ionizing radiation)
What form of radiation forms pyrimidine dimers (or thymine dimers)? - ANSWER UV
rays
Pyrimidine dimers - ANSWER Formation of a chemical bond between adjacent
pyrimidine molecules on the same strand of DNA
Depurination - ANSWER The loss of a purine base from a nucleotide
How many amino acids are encoded in the following RNA sequence?
5' - AUGCCUGAAUGGGCUUUAUGA - 3'
A. 3
B. 4
C. 5
D. 6
E. 7 - ANSWER D (there is no amino acid for a stop codon)
What feature of the polypeptide chain determines the secondary structure of proteins?
A. The last carboxyl group
B. The first amino group
, C. Intra-molecular hydrogen bonding among amino acid units that induces the formation
of alpha-helices and beta-pleated-sheets
D. Interactions among the components of multi-protein complex
E. The hinge regions that allow the alpha-helices and beta-pleated-sheets to fold in
space - ANSWER C
Primary structure of a protein - ANSWER Sequence of amino acids
Secondary structure of a protein - ANSWER Interactions between neighboring amino
acids causing a polypeptide chain to fold and twist (alpha helix and beta pleated sheet -
regional folding)
Tertiary structure of a protein - ANSWER Overall-three dimensional shape of the protein
(when secondary structures fold even further)
Quaternary structure - ANSWER When two or more polypeptide chains associate
When codons that specify the same amino acid differ in ________, a single tRNA may
be able to anneal to several of them through wobble base pairing.
A. Any one of their nucleotides
B. Any two or their nucleotides
C. Their 5' nucleotide
D. Their middle nucleotide
E. Their 3' nucleotide - ANSWER E (wobble takes place on the THIRD position of a
codon and the FIRST position of the anticodon)
Where does wobble take place on the codon? (5' end or 3' end?) - ANSWER 3' end
(third position)
Where does wobble take place on the anticodon? (5' end or 3' end?) - ANSWER 5' end
(first position)
Loss-of-function mutations - ANSWER Cause complete or partial absence of normal
protein function (protein no longer works correctly - example is cystic fibrosis)
Gain-of-function mutation - ANSWER Causes the cell to produce a protein or gene
product whose function is not normally present
Conditional mutations - ANSWER Expressed only under certain conditions (Siamese
cat)
Lethal mutations - ANSWER Cause premature death
Suppressor mutation - ANSWER Genetic change that hides or suppresses the effect of
another mutation (NOT the same as a verse mutation)
CORRECT 100%
The Central Dogma of molecular biology states that, in cells, biological information
_______.
A. Can be transmitted either from DNA to RNA or from RNA to DNA
B. Moves from DNA to RNA to protein
C. Moves from protein to RNA to DNA
D. Moves from DNA to RNA only if encoded by certain viruses
E. Moves from protein to RNA only if encoded by certain viruses - ANSWER B
What is the exception to the Central Dogma rule? - ANSWER RETROVIRUSES
(process goes from RNA to DNA using reverse transcriptase enzymes)
What do retroviruses have that allows them to go from RNA to DNA? - ANSWER
Reverse transcriptase enzymes
What category of transposable elements use an RNA copy of their genome in the
process of transposition?
A. Cut-and-paste transposons
B. Composite bacterial transposons
C. Bacterial insertion sequences
D. Retrotransposons
E. Multiple drug resistance plasmids - ANSWER D
Copy-and-paste transposons a.k.a. replicative transposition - ANSWER A new copy of
the transposable element is introduced at a new site while the old copy remains behind
at the original site (so the number of copies of the transposable element increases)
Transposons a.k.a. transposable elements - ANSWER Sequences that can move about
in the genome and are often a cause of mutations
Are direct repeats part of a transposon? - ANSWER NO
Are inverted repeats part of a transposon? - ANSWER YES
Transposition - ANSWER The movement of a transposon
Cut-and-paste transposons a.k.a. nonreplicative transposition - ANSWER Transposable
element excises from the old site and inserts at a new site WITHOUT any increase in
the number of its copies
Retrotransposons - ANSWER Elements that transpose through an RNA intermediate
,Mutagenic compounds that fit and "get stuck" between nucleotides of DNA molecules
are called ________, whereas mutagenic compounds that cause the covalent
attachment of a methyl or an ethyl group to bases of DNA are called ______.
A. De-aminating agents; reactive oxygen molecules
B. Oxidizing agents; glycosylases
C. Intercalating agents; alkylating agents
D. Hydrolases; base analogs
E. Catalytic converters; organic solvents - ANSWER C
Base analogs - ANSWER Chemicals with structures similar to that of any of the four
standard bases of DNA (DNA polymerase canNOT distinguish these analogs from the
standard bases)
Alkylating agents - ANSWER Chemicals that donate alkyl groups like methyl and ethyl
groups
Deamination - ANSWER Removing an amino group
Intercalating agents - ANSWER Produce mutations by sandwiching themselves
(intercalating) between adjacent bases in DNA, distorting the three-dimensional
structure of the helix and causing single-nucleotide insertions and deletions in
replication
What form of radiation causes double-strand breaks in DNA? - ANSWER X-rays
(ionizing radiation)
What form of radiation forms pyrimidine dimers (or thymine dimers)? - ANSWER UV
rays
Pyrimidine dimers - ANSWER Formation of a chemical bond between adjacent
pyrimidine molecules on the same strand of DNA
Depurination - ANSWER The loss of a purine base from a nucleotide
How many amino acids are encoded in the following RNA sequence?
5' - AUGCCUGAAUGGGCUUUAUGA - 3'
A. 3
B. 4
C. 5
D. 6
E. 7 - ANSWER D (there is no amino acid for a stop codon)
What feature of the polypeptide chain determines the secondary structure of proteins?
A. The last carboxyl group
B. The first amino group
, C. Intra-molecular hydrogen bonding among amino acid units that induces the formation
of alpha-helices and beta-pleated-sheets
D. Interactions among the components of multi-protein complex
E. The hinge regions that allow the alpha-helices and beta-pleated-sheets to fold in
space - ANSWER C
Primary structure of a protein - ANSWER Sequence of amino acids
Secondary structure of a protein - ANSWER Interactions between neighboring amino
acids causing a polypeptide chain to fold and twist (alpha helix and beta pleated sheet -
regional folding)
Tertiary structure of a protein - ANSWER Overall-three dimensional shape of the protein
(when secondary structures fold even further)
Quaternary structure - ANSWER When two or more polypeptide chains associate
When codons that specify the same amino acid differ in ________, a single tRNA may
be able to anneal to several of them through wobble base pairing.
A. Any one of their nucleotides
B. Any two or their nucleotides
C. Their 5' nucleotide
D. Their middle nucleotide
E. Their 3' nucleotide - ANSWER E (wobble takes place on the THIRD position of a
codon and the FIRST position of the anticodon)
Where does wobble take place on the codon? (5' end or 3' end?) - ANSWER 3' end
(third position)
Where does wobble take place on the anticodon? (5' end or 3' end?) - ANSWER 5' end
(first position)
Loss-of-function mutations - ANSWER Cause complete or partial absence of normal
protein function (protein no longer works correctly - example is cystic fibrosis)
Gain-of-function mutation - ANSWER Causes the cell to produce a protein or gene
product whose function is not normally present
Conditional mutations - ANSWER Expressed only under certain conditions (Siamese
cat)
Lethal mutations - ANSWER Cause premature death
Suppressor mutation - ANSWER Genetic change that hides or suppresses the effect of
another mutation (NOT the same as a verse mutation)
