Next Generation DNA Sequencing Exam Questions and Answers Graded A+
NGS Background - Answers 1990 - Lynx Therapeutics Massively Parallel Signature Sequencing (MPSS)-
>biggest revolution in molecular biology after sanger sequencing and PCR
First Generation Sequencing (FGS) - Answers A low-throughput sequencing method that allows
sequencing of a specific region of the genome (Sanger Method), low error rate, easy to anylyze-can do
manually
Next Generation Sequencing (NGS) - Answers A high-throughput sequencing method that parallelizes
the sequencing process, producing thousands or millions of sequences at once (second and third)
Third Generation Sequencing - Answers • Lower output • Longer sequences (reads) • Single molecule
sequencing; can amp 1 molecule of DNA
The Single Molecule Sequencing is uninterrupted and detected in REAL TIME- ^ error rate can correct
b/c overlapping seq-no limitation, can code entire RNA seq, current disrupted when nucleotide passes
through nanopore and is sequenced
Second Generation Sequencing - Answers • Higher output • Short sequences (reads)-shorter than
Sanger 250bp • Amplification step; costs less b/c amnt you can generate at the same time
How Sanger Method works - Answers Sanger Sequencing developed by Fred Sanger et al in 1977
Uses dideoxynucleotides for chain termination, generating fragments of different lengths ending in
ddATP, ddGTP, ddCTP or ddTTP
-normal has 3'-OH required for chain elongation; chain terminator has H
NGS: Second generation DNA Sequencing Uses - Answers Illumina, Ion Torrent, Scope
Illumina Workflow starts with which step? What happens here? - Answers Library preparation (6hr w/
3hr hands on): Genomic DNA (or RNA> cDNA) is fragmented and adapters are ligated to each fragment.
The adapters link the DNA fragments to the flowcell surface.
Fragment DNA->repair ends. add A overhang -> ligate adapters -> select ligated DNA
Illumina Workflow second step: - Answers 2) Cluster Generation (4 hrs, 5 minutes hands on, 1-96
samples): The template needs many clonal copies (clusters) to generate enough light to be recorded by
the camera! The fragments can be sequenced in both directions (Paired-end Sequencing); attach DNA to
flow cell-> perform bridge amplification->generate clusters-> anneal sequencing primer
Illumina Workflow third step: - Answers 3) Sequencing by Synthesis: Every cycle a dNTP is incorporated,
a process that starts a chemical cascade that produces light recorded by a camera. Each dNTP (A, C, G, T)
has a specific light spectrum dNTP added-> light -> identified bp
"Paired" meaning and role - Answers 'Paired-ends' refers to the two ends of the same DNA molecule
, • Genomic DNA is sheared into fragments of 300-1000 bp
• Adaptors are added to the end of each fragment
• Each fragment/molecule of DNA is sequenced from both ends
With different protocols relying on DNA circularization, long paired end libraries (mate pair) can be
generated (up to 40 Kb)
genomic DNA->fragment (200-500 bp) -> ligate adapters-> generate clusters-sequence 1st end ->
regenerate clusters & sequence paired end
Why is Paired-End important? - Answers 1 - To anchor contigs->scaffolds
Ex: contigs AGTTCCATGATACGCACGCTTACACCGACATGCG
Single-End reads CATGATACGCAAACC
Paired-End reads ATGATACGCA___CGCTTACATGC
1000bp sequenced 200 beg and end of fragment- too long other, too short, wont bridge properly (seq->
fragment -> substrate)
2 - To correctly evaluate the expression of different genes or isoforms
Gene 1
CTGATAGAGAGAGAGAGAGCTGGCTAATCACCC
Gene 2 AGAGAGAGAGAGAGATTA
Single-End reads AGAGAGAGAGAGAG
Paired-End reads AGAGAGAGAGAGAG__AATCACCC
3 - To create longer reads by overlapping
Single-End reads (100bp) ...ACACCGACATGCGA...
Paired-End reads (2 x 100bp)...ACACCGACATGCGA CGACGACATGCG...
IonTorrent sequencing (NextGen) - Answers - No Laser, Camera and Fluorescence
- Semiconductor sequencing chips produced in standard CMOS factories
- When a nucleotide is incorporated, a H+ is released and state solid PHmeter detects the voltage
difference calling the base
- Read Length: > 400bb
NGS Background - Answers 1990 - Lynx Therapeutics Massively Parallel Signature Sequencing (MPSS)-
>biggest revolution in molecular biology after sanger sequencing and PCR
First Generation Sequencing (FGS) - Answers A low-throughput sequencing method that allows
sequencing of a specific region of the genome (Sanger Method), low error rate, easy to anylyze-can do
manually
Next Generation Sequencing (NGS) - Answers A high-throughput sequencing method that parallelizes
the sequencing process, producing thousands or millions of sequences at once (second and third)
Third Generation Sequencing - Answers • Lower output • Longer sequences (reads) • Single molecule
sequencing; can amp 1 molecule of DNA
The Single Molecule Sequencing is uninterrupted and detected in REAL TIME- ^ error rate can correct
b/c overlapping seq-no limitation, can code entire RNA seq, current disrupted when nucleotide passes
through nanopore and is sequenced
Second Generation Sequencing - Answers • Higher output • Short sequences (reads)-shorter than
Sanger 250bp • Amplification step; costs less b/c amnt you can generate at the same time
How Sanger Method works - Answers Sanger Sequencing developed by Fred Sanger et al in 1977
Uses dideoxynucleotides for chain termination, generating fragments of different lengths ending in
ddATP, ddGTP, ddCTP or ddTTP
-normal has 3'-OH required for chain elongation; chain terminator has H
NGS: Second generation DNA Sequencing Uses - Answers Illumina, Ion Torrent, Scope
Illumina Workflow starts with which step? What happens here? - Answers Library preparation (6hr w/
3hr hands on): Genomic DNA (or RNA> cDNA) is fragmented and adapters are ligated to each fragment.
The adapters link the DNA fragments to the flowcell surface.
Fragment DNA->repair ends. add A overhang -> ligate adapters -> select ligated DNA
Illumina Workflow second step: - Answers 2) Cluster Generation (4 hrs, 5 minutes hands on, 1-96
samples): The template needs many clonal copies (clusters) to generate enough light to be recorded by
the camera! The fragments can be sequenced in both directions (Paired-end Sequencing); attach DNA to
flow cell-> perform bridge amplification->generate clusters-> anneal sequencing primer
Illumina Workflow third step: - Answers 3) Sequencing by Synthesis: Every cycle a dNTP is incorporated,
a process that starts a chemical cascade that produces light recorded by a camera. Each dNTP (A, C, G, T)
has a specific light spectrum dNTP added-> light -> identified bp
"Paired" meaning and role - Answers 'Paired-ends' refers to the two ends of the same DNA molecule
, • Genomic DNA is sheared into fragments of 300-1000 bp
• Adaptors are added to the end of each fragment
• Each fragment/molecule of DNA is sequenced from both ends
With different protocols relying on DNA circularization, long paired end libraries (mate pair) can be
generated (up to 40 Kb)
genomic DNA->fragment (200-500 bp) -> ligate adapters-> generate clusters-sequence 1st end ->
regenerate clusters & sequence paired end
Why is Paired-End important? - Answers 1 - To anchor contigs->scaffolds
Ex: contigs AGTTCCATGATACGCACGCTTACACCGACATGCG
Single-End reads CATGATACGCAAACC
Paired-End reads ATGATACGCA___CGCTTACATGC
1000bp sequenced 200 beg and end of fragment- too long other, too short, wont bridge properly (seq->
fragment -> substrate)
2 - To correctly evaluate the expression of different genes or isoforms
Gene 1
CTGATAGAGAGAGAGAGAGCTGGCTAATCACCC
Gene 2 AGAGAGAGAGAGAGATTA
Single-End reads AGAGAGAGAGAGAG
Paired-End reads AGAGAGAGAGAGAG__AATCACCC
3 - To create longer reads by overlapping
Single-End reads (100bp) ...ACACCGACATGCGA...
Paired-End reads (2 x 100bp)...ACACCGACATGCGA CGACGACATGCG...
IonTorrent sequencing (NextGen) - Answers - No Laser, Camera and Fluorescence
- Semiconductor sequencing chips produced in standard CMOS factories
- When a nucleotide is incorporated, a H+ is released and state solid PHmeter detects the voltage
difference calling the base
- Read Length: > 400bb
