A(MB) ASCP Practice Exam Questions With 100%
Correct Answers Verified (2023-2024) (155 Questions)
fragment of 350 bp. You would expect a heterozygous person for gene X to
have these fragments on a restriction gel:
+/+ = 350 bp; 250 bp; 100 bp;
m/+ = Only the 350 bp
m/+ = 350 bp; 250 bp; 100 bp
m/m = 350 bp; 250 bp - correct answers ✅m/+ = 350 bp; 250 bp; 100 bp
Which of the following will more likely lower stringency conditions in the
washing step of a hybridization experiment?
Increase the concentration of salt in the wash solution buffer
Increase the temperature from, say 68°C to 75°C
Use a probe with a higher density of GC base pairs as compared to one with
a lower GC base pair density
Remove formamide from the wash solution buffer - correct answers
✅Increase the concentration of salt in the wash solution buffer
What enzyme is involved in LCR? - correct answers ✅DNA Ligase
Next Generation Sequencing set-up require:
,A(MB) ASCP Practice Exam Questions With 100%
Correct Answers Verified (2023-2024) (155 Questions)
Library preparation and extensive bioinformatics analysis
BAC clones
Use of translation factors
Hybridization - correct answers ✅Library preparation and extensive
bioinformatics analysis
Which of the subunits of RNA polymerase holoenzyme is responsible for
promoter recognition?
Beta subunit
Sigma subunit
Gamma subunit
Delta subunit - correct answers ✅Sigma subunit
While at the doctor's office with your father, you overheard his physician tell
another physician that test results came in, confirming the presence of the
Factor V Leiden mutation, a mutation associated with deep venous
thrombosis. Which of the following is the mutation your father has:
A1691G
G1619A
,A(MB) ASCP Practice Exam Questions With 100%
Correct Answers Verified (2023-2024) (155 Questions)
1691G>A
C282Y - correct answers ✅1691G>A
Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a
hybridization procedure. What is the melting temperature, Tm, of the
sequence?
60°C
58°C
64°C
62°C - correct answers ✅58°C
This polymerase acts on DNA and produces Ribosomal RNA:
RNA Pol I
DNA Pol I
RNA Pol II
DNA Pol II - correct answers ✅RNA Pol I
, A(MB) ASCP Practice Exam Questions With 100%
Correct Answers Verified (2023-2024) (155 Questions)
Sickle cell disease is an autosomal genetic disease due to a point mutation in
the beta-globin gene, where glutamic acid is substituted for valine at the
sixth codon of the gene, resulting in a faulty hemoglobin S (Hb S). Sickle cell
disease is one of many genetic diseases where a single gene controls the
expression of many phenotypic traits. The phenomenon where a single gene
controls the expression of many phenotypic traits is best referred to as: -
correct answers ✅Pleiotrophy
What assay amplifies the target using a combination of a three-enzyme
system?
Branched DNA
TMA
PCR
NASBA
LCR - correct answers ✅NASBA
In what part of a qPCR Amplification Plot do you take your measurement? -
correct answers ✅Exponential phase
Correct Answers Verified (2023-2024) (155 Questions)
fragment of 350 bp. You would expect a heterozygous person for gene X to
have these fragments on a restriction gel:
+/+ = 350 bp; 250 bp; 100 bp;
m/+ = Only the 350 bp
m/+ = 350 bp; 250 bp; 100 bp
m/m = 350 bp; 250 bp - correct answers ✅m/+ = 350 bp; 250 bp; 100 bp
Which of the following will more likely lower stringency conditions in the
washing step of a hybridization experiment?
Increase the concentration of salt in the wash solution buffer
Increase the temperature from, say 68°C to 75°C
Use a probe with a higher density of GC base pairs as compared to one with
a lower GC base pair density
Remove formamide from the wash solution buffer - correct answers
✅Increase the concentration of salt in the wash solution buffer
What enzyme is involved in LCR? - correct answers ✅DNA Ligase
Next Generation Sequencing set-up require:
,A(MB) ASCP Practice Exam Questions With 100%
Correct Answers Verified (2023-2024) (155 Questions)
Library preparation and extensive bioinformatics analysis
BAC clones
Use of translation factors
Hybridization - correct answers ✅Library preparation and extensive
bioinformatics analysis
Which of the subunits of RNA polymerase holoenzyme is responsible for
promoter recognition?
Beta subunit
Sigma subunit
Gamma subunit
Delta subunit - correct answers ✅Sigma subunit
While at the doctor's office with your father, you overheard his physician tell
another physician that test results came in, confirming the presence of the
Factor V Leiden mutation, a mutation associated with deep venous
thrombosis. Which of the following is the mutation your father has:
A1691G
G1619A
,A(MB) ASCP Practice Exam Questions With 100%
Correct Answers Verified (2023-2024) (155 Questions)
1691G>A
C282Y - correct answers ✅1691G>A
Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a
hybridization procedure. What is the melting temperature, Tm, of the
sequence?
60°C
58°C
64°C
62°C - correct answers ✅58°C
This polymerase acts on DNA and produces Ribosomal RNA:
RNA Pol I
DNA Pol I
RNA Pol II
DNA Pol II - correct answers ✅RNA Pol I
, A(MB) ASCP Practice Exam Questions With 100%
Correct Answers Verified (2023-2024) (155 Questions)
Sickle cell disease is an autosomal genetic disease due to a point mutation in
the beta-globin gene, where glutamic acid is substituted for valine at the
sixth codon of the gene, resulting in a faulty hemoglobin S (Hb S). Sickle cell
disease is one of many genetic diseases where a single gene controls the
expression of many phenotypic traits. The phenomenon where a single gene
controls the expression of many phenotypic traits is best referred to as: -
correct answers ✅Pleiotrophy
What assay amplifies the target using a combination of a three-enzyme
system?
Branched DNA
TMA
PCR
NASBA
LCR - correct answers ✅NASBA
In what part of a qPCR Amplification Plot do you take your measurement? -
correct answers ✅Exponential phase
