BIOLOGY 100 EXAM 1 EKDALE SDSU
STUDY MATERIAL 2026 TESTED
QUESTIONS AND ACCURATE
SOLUTIONS
◉ DNA carries out two basic functions in cells: (1) information storage
and transfer (genes can be copied and passed to offspring) and (2) the
"blueprint" function (genes provide instructions for building proteins).
The key process for information storage and transfer to offspring cells is
_____.
Answer: DNA replication.
◉ A gene is a sequence of DNA nucleotide bases that codes for a single
protein. Approximately how many nucleotide bases would be required to
code for a protein chain that is 100 amino acids long?
Answer: 300
◉ tRNA molecules work to _____.
Answer: translate mRNA to produce a specific amino acid sequence
◉ A particular gene does NOT constantly churn out the same protein at
all times in every cell. This is true for two reasons. First, _____ can
allow one gene to produce several different proteins. Second, genes are
constantly being turned on and off through the process of _____.
Answer: mRNA processing ... gene regulation
, ◉ If you analyzed the nucleotide content of DNA, you would expect to
find that __________.
Answer: the ratio of A to T is close to 1:1 and the ratio of G to C is close
to 1:1
◉ Life on Mars is finally discovered and a new organism that has six
different nucleotides that encode 30 different amino acids is found on
this planet. Which of the following nucleotide combinations would
encode the minimum number of amino acids needed in this organism?
Answer: two-nucleotide sequence (62 combinations)
◉ Consider the following sequence and explain what effect the mutation
has on the protein that is
translated.UCUAUGUUUCACAGAGGGAAACCCUAACCC (wild
type)UCUAUGUUUCACUGAGGGAAACCCUAACCC (mutant)
Answer: prematurely stops the translation of the protein
◉ Which of the following statements correctly describes mRNA
processing in eukaryotes?
Answer: Introns are cut out, and the resulting exons are spliced together.
◉ The nucleotide sequence of a DNA codon is GTA. A messenger RNA
molecule with a complementary codon is transcribed from the DNA. In
the process of protein synthesis, a tRNA pairs with the mRNA codon.
What is the nucleotide sequence of the tRNA anticodon?
Answer: GUA
STUDY MATERIAL 2026 TESTED
QUESTIONS AND ACCURATE
SOLUTIONS
◉ DNA carries out two basic functions in cells: (1) information storage
and transfer (genes can be copied and passed to offspring) and (2) the
"blueprint" function (genes provide instructions for building proteins).
The key process for information storage and transfer to offspring cells is
_____.
Answer: DNA replication.
◉ A gene is a sequence of DNA nucleotide bases that codes for a single
protein. Approximately how many nucleotide bases would be required to
code for a protein chain that is 100 amino acids long?
Answer: 300
◉ tRNA molecules work to _____.
Answer: translate mRNA to produce a specific amino acid sequence
◉ A particular gene does NOT constantly churn out the same protein at
all times in every cell. This is true for two reasons. First, _____ can
allow one gene to produce several different proteins. Second, genes are
constantly being turned on and off through the process of _____.
Answer: mRNA processing ... gene regulation
, ◉ If you analyzed the nucleotide content of DNA, you would expect to
find that __________.
Answer: the ratio of A to T is close to 1:1 and the ratio of G to C is close
to 1:1
◉ Life on Mars is finally discovered and a new organism that has six
different nucleotides that encode 30 different amino acids is found on
this planet. Which of the following nucleotide combinations would
encode the minimum number of amino acids needed in this organism?
Answer: two-nucleotide sequence (62 combinations)
◉ Consider the following sequence and explain what effect the mutation
has on the protein that is
translated.UCUAUGUUUCACAGAGGGAAACCCUAACCC (wild
type)UCUAUGUUUCACUGAGGGAAACCCUAACCC (mutant)
Answer: prematurely stops the translation of the protein
◉ Which of the following statements correctly describes mRNA
processing in eukaryotes?
Answer: Introns are cut out, and the resulting exons are spliced together.
◉ The nucleotide sequence of a DNA codon is GTA. A messenger RNA
molecule with a complementary codon is transcribed from the DNA. In
the process of protein synthesis, a tRNA pairs with the mRNA codon.
What is the nucleotide sequence of the tRNA anticodon?
Answer: GUA
