BIOL 4003 EXAM I question well
answered
Homologous chromosomes are inherited from two parents while sister chromatids are
generated by DNA replication - ANS ✔✔True
DNA replicates conservatively, which means that one of the two daughter double helices is "old"
and the other is "new." - ANS ✔✔False - semi conservative replication
Which of these cellular components are not used during translation?
I. DNA
II. DNA Polymerase
III. mRNA
IV. DNA dependent RNA Polymerase
V. ribosomal RNA
VI. tRNA - ANS ✔✔I, II and IV only
You assess the nucleic acids from a novel virus to determine the base composition. You obtain
the following results: 35% A, 15% T, 25% G, and 25% C.
What is the most likely physical nature of the genome from this virus? - ANS ✔✔single-stranded
DNA
The cartoons below draw potential transcription bubbles. If I tell you that the top strand is the
template strand, which cartoon below depicts the expected transcription bubble most
accurately? - ANS ✔✔DNA replicated in the 5' > 3' direction
,nucleotides added to the 3' end
The cultivated potato, Solanum tuberosum, is an autotetraploid organism. Its ploidy can be
represented by 2n = 4x = 48. How many chromosomes would you expect to find in a somatic cell
(such as a guard cell) and a germ cell (such as an egg cell)? - ANS ✔✔Guard cell - 48 (2n), Egg
cell - 24 (n)
Mitosis phases - ANS ✔✔
Meiosis I phases - ANS ✔✔
Meiosis II phases - ANS ✔✔
Which of the following is true of prokaryotic mRNA transcripts? - ANS ✔✔The Shine−Dalgarno
box associates with an RNA component in the small subunit of ribosomes.
Below is the sequence of the template and coding strands of a piece of DNA. Transcription starts
at the underlined base. What is the RNA sequence that would be transcribed from this piece of
DNA.
5' ATGCTTG^GCAAT 3' Template strand
3' TACGAAC^CGTTA 5' Coding strand - ANS ✔✔5' CAAGCAU 3'
E. coli cells that have been growing in 14N for many generations are transferred to medium
containing only 15N and allowed to grow in this medium for three generations. Their DNA is
then extracted and analyzed by equilibrium CsCl density-gradient centrifugation. What
proportion of this DNA will band at the "light," "hybrid," and "heavy" positions in the gradient? -
ANS ✔✔0% light, 25% hybrid, 75% heavy
, Below is a cartoon of a DNA replication bubble. In which boxed regions would you expect to find
Okazaki fragments? - ANS ✔✔
If the average molecular mass of an amino acid is assumed to be 100 daltons, about how many
nucleotides will be present in an mRNA coding sequence specifying a single polypeptide with a
molecular mass of 27,000 daltons? - ANS ✔✔813
(27,000/100)x3 + 3
This is the entire transcript sequence of the non-template (or "coding") strand of the t-RNA
gene, At1g026000, from Arabidopsis thaliana.
5' - GGCTGTAGTTTAGTGGTAAGAATTCCACGTTGTGGCCGTGGAGACCTGGGCTCGAATCCCAGCAGC 3'
The bases that will become the anticodon are underlined. Which amino acid will the mature t-
RNA be charged with? - ANS ✔✔Histidine
Shorter molecules of DNA will migrate faster through an agarose genes than longer molecules &
cacsl - ANS ✔✔True
A cDNA library will contain fragments of both genes and intergenic sequences (the regions in
between genes). - ANS ✔✔False
A mutation results in a change of an Alanine amino acid to a Valine amino acid at position 9 of a
protein. Which term best describes this mutation? - ANS ✔✔Missense mutation
(1AA)
answered
Homologous chromosomes are inherited from two parents while sister chromatids are
generated by DNA replication - ANS ✔✔True
DNA replicates conservatively, which means that one of the two daughter double helices is "old"
and the other is "new." - ANS ✔✔False - semi conservative replication
Which of these cellular components are not used during translation?
I. DNA
II. DNA Polymerase
III. mRNA
IV. DNA dependent RNA Polymerase
V. ribosomal RNA
VI. tRNA - ANS ✔✔I, II and IV only
You assess the nucleic acids from a novel virus to determine the base composition. You obtain
the following results: 35% A, 15% T, 25% G, and 25% C.
What is the most likely physical nature of the genome from this virus? - ANS ✔✔single-stranded
DNA
The cartoons below draw potential transcription bubbles. If I tell you that the top strand is the
template strand, which cartoon below depicts the expected transcription bubble most
accurately? - ANS ✔✔DNA replicated in the 5' > 3' direction
,nucleotides added to the 3' end
The cultivated potato, Solanum tuberosum, is an autotetraploid organism. Its ploidy can be
represented by 2n = 4x = 48. How many chromosomes would you expect to find in a somatic cell
(such as a guard cell) and a germ cell (such as an egg cell)? - ANS ✔✔Guard cell - 48 (2n), Egg
cell - 24 (n)
Mitosis phases - ANS ✔✔
Meiosis I phases - ANS ✔✔
Meiosis II phases - ANS ✔✔
Which of the following is true of prokaryotic mRNA transcripts? - ANS ✔✔The Shine−Dalgarno
box associates with an RNA component in the small subunit of ribosomes.
Below is the sequence of the template and coding strands of a piece of DNA. Transcription starts
at the underlined base. What is the RNA sequence that would be transcribed from this piece of
DNA.
5' ATGCTTG^GCAAT 3' Template strand
3' TACGAAC^CGTTA 5' Coding strand - ANS ✔✔5' CAAGCAU 3'
E. coli cells that have been growing in 14N for many generations are transferred to medium
containing only 15N and allowed to grow in this medium for three generations. Their DNA is
then extracted and analyzed by equilibrium CsCl density-gradient centrifugation. What
proportion of this DNA will band at the "light," "hybrid," and "heavy" positions in the gradient? -
ANS ✔✔0% light, 25% hybrid, 75% heavy
, Below is a cartoon of a DNA replication bubble. In which boxed regions would you expect to find
Okazaki fragments? - ANS ✔✔
If the average molecular mass of an amino acid is assumed to be 100 daltons, about how many
nucleotides will be present in an mRNA coding sequence specifying a single polypeptide with a
molecular mass of 27,000 daltons? - ANS ✔✔813
(27,000/100)x3 + 3
This is the entire transcript sequence of the non-template (or "coding") strand of the t-RNA
gene, At1g026000, from Arabidopsis thaliana.
5' - GGCTGTAGTTTAGTGGTAAGAATTCCACGTTGTGGCCGTGGAGACCTGGGCTCGAATCCCAGCAGC 3'
The bases that will become the anticodon are underlined. Which amino acid will the mature t-
RNA be charged with? - ANS ✔✔Histidine
Shorter molecules of DNA will migrate faster through an agarose genes than longer molecules &
cacsl - ANS ✔✔True
A cDNA library will contain fragments of both genes and intergenic sequences (the regions in
between genes). - ANS ✔✔False
A mutation results in a change of an Alanine amino acid to a Valine amino acid at position 9 of a
protein. Which term best describes this mutation? - ANS ✔✔Missense mutation
(1AA)
