GENIUSDOCLIBZ
Test Bank - Essentials of Genetics, 10th
Edition (Klug, 2020), Chapter 1-21 + Special
Topics | All Chapters
written by
Testbankguides
The Marketplace to Buy and Sell your Study Material
At Stuvia, you will find the best notes, summaries, flashcards & other study material. Search for your
school or uni and find the study material you need.
www.stuvia.com
Downloaded by: Testbankguides | Want to earn $1.236
Distribution of this document is illegal extra per year?
, Stuvia.com - The Marketplace to Buy and Sell your Study Material
GENIUSDOCLIBZ
Downloaded by: Testbankguides | Want to earn $1.236
Distribution of this document is illegal extra per year?
, Stuvia.com - The Marketplace to Buy and Sell your Study Material
GENIUSDOCLIBZ
Focus on essential genetic topics and
explore the latest breakthroughs
Known for its focus on conceptual understanding, problem solving, and practical
applications, the bestselling Essentials of Genetics strengthens problem-solving
skills and explores the essential genetics topics that today’s students need
to understand. The 10th Edition has been extensively updated to provide
comprehensive coverage of important, emerging topics such as CRISPR-Cas,
epigenetics, and genetic testing. Mastering Genetics includes new tutorials
on topics such as CRISPR-Cas and epigenetics, and new, mobile-ready Dynamic
Study Modules, which prepare students for class and support the learning of
key concepts.
Spencer | Palladino | Killian
Klug | Cummings
genetics. Chromosomes are
to be observed in living cells.
recognizable human chromo-
pear only once in the lifetime
rch, there are still mysteries
n chromosomes. We discuss
Sequence Organization.
and practical applications, the
lls and explores the essential
Edition has been extensively
g topics such as CRISPR-Cas,
cs chapter covers Advances
ESSENTIALS of GENETICS
says on Genetics, Ethics, and
into everyday life.
Tenth Edition
ESSENTIALS
ent, in mind, offering:
r feedback
ncludes embedded videos
of GENETICS
ore—all accessible on any
ne.
ild your confidence on
a time, indicating your
ons, you’re given feedback
smartphones, tablets,
Klug | Cummings | Spencer | Palladino | Killian
r lengthy discussion for every
s, including extra study prob-
ow to study genetics.
www.pearson.com for more information.
our products, contact our customer service
00) 824-7799, or (201) 767-5021 outside of
your campus bookstore.
www.pearson.com
Tenth
Edition
A01_KLUG8414_10_SE_FM.indd 1 Downloaded by: Testbankguides | Want to earn $1.236 16/11/18 5:08
Distribution of this document is illegal extra per year?
, Stuvia.com - The Marketplace to Buy and Sell your Study Material
GENIUSDOCLIBZ
Make genetics relevant . . .
NEW! Regulation
16
of gene expression
has been expanded
and is now divided into
coverage of bacteria
Regulation of in Chapter 15 and
Gene Expression in coverage of eukaryotes
Eukaryotes in Chapter 16.
CHAPTER CONCEPTS
■■ While transcription and translation are
tightly coupled in bacteria, in eukary-
otes, these processes are spatially and
temporally separated, and thus inde-
Chromosome territories in a human fibroblast cell nucleus. Each
pendently regulated. chromosome is stained with a different-colored probe.
■■ Chromatin remodeling, as well as
modifications to DNA and histones,
play important roles in regulating gene
expression in eukaryotes.
V
■■ Eukaryotic transcription initiation irtually all cells in a multicellular eukaryotic organism contain a
requires the assembly of transcrip- complete genome; however, such organisms often possess differ-
tion regulatory proteins on DNA sites ent cell types with diverse morphologies and functions. This simple
known as promoters, enhancers, and observation highlights the importance of the regulation of gene expression
silencers. in eukaryotes. For example, skin cells and muscle cells differ in appearance
■■ Following transcription, there are sev- and function because they express different genes. Skin cells express kera-
eral mechanisms that regulate gene tins, fibrous structural proteins that bestow the skin with protective prop-
expression, referred to as posttranscrip- erties. Muscle cells express high levels of myosin II, a protein that mediates
tional regulation. muscle contraction. Skin cells do not express myosin II, and muscle cells do
■■ Alternative splicing allows for a single not express keratins.
gene to encode different protein iso- In addition to gene expression that is cell-type specific, some genes are
forms with different functions. only expressed under certain conditions or at certain times. For example,
■■ RNA-binding proteins regulate mRNA when oxygen levels in the blood are low, such as at high altitude or after
stability, degradation, localization, and rigorous exercise, expression of the hormone erythropoietin is upregulated,
translation. which leads to an increase in red blood cell production and thus oxygen-
■■ Noncoding RNAs may regulate gene carrying capacity.
expression by targeting mRNAs for Underscoring the importance of regulation, the misregulation of genes
destruction or translational inhibition.
P. 302
in eukaryotes is associated with developmental defects and disease. For
■■ Posttranslational modification of pro- instance, the overexpression of genes that regulate cellular growth can
their degradation.
298
teins can alter their activity or promote lead15to uncontrolled
RegulAtioN cellularof
proliferation, a hallmark of cancer.
geNe expRessioN Therefore,
iN BActeRiA
understanding the mechanisms that control gene expression in eukaryotes
is of great interest and may lead to therapies for human diseases.
Coverage of Streptococcus thermophilus CRISPR locus
CRISPR-Cas
302 Repeats
is expanded GTTTTTGTACTCTCAAGATTTAAGTAACTGTACAAC
and Leader
integrated
M16_KLUG8414_10_SE_C16.indd 302 14/09/2018 13:58
in multiple
chapters – Spacer 1 Spacer 3
GAGCTACCAGCTACCCCGTATGTCAGAGAG TAGATTTAATCAGTAATGAGTTAGGCATAA
Chapters 1, 15, (Streptococcus phage 20617) (Streptococcus phage TP-778L)
17, and Special Spacer 2
TTGAATACCAATGCCAGCTTCTTTTAAGGC
Topics Chapters (Streptococcus phage CHPC1151)
ST3 and ST6.
FIGURE 15.13 A cRispR locus from the bacterium Streptococcus thermophilus (lMg18311).
spacer sequences are derived from portions of bacteriophage genomes and are flanked on
either side by a repeat sequence. only 3 of 33 total spacers in this cRispR locus are shown.
P. 298
description of repeated DNA sequences with nonrepetitive genes encode a wide variety of Cas proteins such as DNases,
spacer sequences between them. Since then, CRISPR loci RNases, and proteins of unknown function. The CRISPR-Cas
have been identified in ∙ 50 percent of bacteria species mechanism includes three steps outlined in Figure 15.14.
and in ∙ 90 percent of archaea, another type of prokaryote
1. The first step is known as spacer acquisition. Invading
(Figure 15.13). The spacers remained a mystery until 2005
phage DNA is cleaved into small fragments, which are
when three independent studies demonstrated that CRISPR
directly inserted into the CRISPR locus to become new
spacer sequences were identical to fragments of phage
spacers. The Cas1 nuclease and an associated Cas2 pro-
genomes. This insight led to speculation that viral sequences
tein are required for spacer acquisition. New spacers are
within CRISPR loci serve as a “molecular memory” of previ-
inserted proximal to the leader sequence of the CRISPR
ous viral attacks.
locus, with older spacers being located progressively more
A01_KLUG8414_10_SE_FM.indd 2 Downloaded by: Testbankguides |
The first experimental evidence that CRISPRs are impor- Want to earn $1.236 16/11/18 5:08
distal. When new spacers are added, repeat sequences are
tant for adaptive immunity came from an unexpected place.
Distribution of this document is illegal extra per year?
duplicated such that each spacer is flanked by repeats.
Danisco, a Danish food science company, sought to create a
Test Bank - Essentials of Genetics, 10th
Edition (Klug, 2020), Chapter 1-21 + Special
Topics | All Chapters
written by
Testbankguides
The Marketplace to Buy and Sell your Study Material
At Stuvia, you will find the best notes, summaries, flashcards & other study material. Search for your
school or uni and find the study material you need.
www.stuvia.com
Downloaded by: Testbankguides | Want to earn $1.236
Distribution of this document is illegal extra per year?
, Stuvia.com - The Marketplace to Buy and Sell your Study Material
GENIUSDOCLIBZ
Downloaded by: Testbankguides | Want to earn $1.236
Distribution of this document is illegal extra per year?
, Stuvia.com - The Marketplace to Buy and Sell your Study Material
GENIUSDOCLIBZ
Focus on essential genetic topics and
explore the latest breakthroughs
Known for its focus on conceptual understanding, problem solving, and practical
applications, the bestselling Essentials of Genetics strengthens problem-solving
skills and explores the essential genetics topics that today’s students need
to understand. The 10th Edition has been extensively updated to provide
comprehensive coverage of important, emerging topics such as CRISPR-Cas,
epigenetics, and genetic testing. Mastering Genetics includes new tutorials
on topics such as CRISPR-Cas and epigenetics, and new, mobile-ready Dynamic
Study Modules, which prepare students for class and support the learning of
key concepts.
Spencer | Palladino | Killian
Klug | Cummings
genetics. Chromosomes are
to be observed in living cells.
recognizable human chromo-
pear only once in the lifetime
rch, there are still mysteries
n chromosomes. We discuss
Sequence Organization.
and practical applications, the
lls and explores the essential
Edition has been extensively
g topics such as CRISPR-Cas,
cs chapter covers Advances
ESSENTIALS of GENETICS
says on Genetics, Ethics, and
into everyday life.
Tenth Edition
ESSENTIALS
ent, in mind, offering:
r feedback
ncludes embedded videos
of GENETICS
ore—all accessible on any
ne.
ild your confidence on
a time, indicating your
ons, you’re given feedback
smartphones, tablets,
Klug | Cummings | Spencer | Palladino | Killian
r lengthy discussion for every
s, including extra study prob-
ow to study genetics.
www.pearson.com for more information.
our products, contact our customer service
00) 824-7799, or (201) 767-5021 outside of
your campus bookstore.
www.pearson.com
Tenth
Edition
A01_KLUG8414_10_SE_FM.indd 1 Downloaded by: Testbankguides | Want to earn $1.236 16/11/18 5:08
Distribution of this document is illegal extra per year?
, Stuvia.com - The Marketplace to Buy and Sell your Study Material
GENIUSDOCLIBZ
Make genetics relevant . . .
NEW! Regulation
16
of gene expression
has been expanded
and is now divided into
coverage of bacteria
Regulation of in Chapter 15 and
Gene Expression in coverage of eukaryotes
Eukaryotes in Chapter 16.
CHAPTER CONCEPTS
■■ While transcription and translation are
tightly coupled in bacteria, in eukary-
otes, these processes are spatially and
temporally separated, and thus inde-
Chromosome territories in a human fibroblast cell nucleus. Each
pendently regulated. chromosome is stained with a different-colored probe.
■■ Chromatin remodeling, as well as
modifications to DNA and histones,
play important roles in regulating gene
expression in eukaryotes.
V
■■ Eukaryotic transcription initiation irtually all cells in a multicellular eukaryotic organism contain a
requires the assembly of transcrip- complete genome; however, such organisms often possess differ-
tion regulatory proteins on DNA sites ent cell types with diverse morphologies and functions. This simple
known as promoters, enhancers, and observation highlights the importance of the regulation of gene expression
silencers. in eukaryotes. For example, skin cells and muscle cells differ in appearance
■■ Following transcription, there are sev- and function because they express different genes. Skin cells express kera-
eral mechanisms that regulate gene tins, fibrous structural proteins that bestow the skin with protective prop-
expression, referred to as posttranscrip- erties. Muscle cells express high levels of myosin II, a protein that mediates
tional regulation. muscle contraction. Skin cells do not express myosin II, and muscle cells do
■■ Alternative splicing allows for a single not express keratins.
gene to encode different protein iso- In addition to gene expression that is cell-type specific, some genes are
forms with different functions. only expressed under certain conditions or at certain times. For example,
■■ RNA-binding proteins regulate mRNA when oxygen levels in the blood are low, such as at high altitude or after
stability, degradation, localization, and rigorous exercise, expression of the hormone erythropoietin is upregulated,
translation. which leads to an increase in red blood cell production and thus oxygen-
■■ Noncoding RNAs may regulate gene carrying capacity.
expression by targeting mRNAs for Underscoring the importance of regulation, the misregulation of genes
destruction or translational inhibition.
P. 302
in eukaryotes is associated with developmental defects and disease. For
■■ Posttranslational modification of pro- instance, the overexpression of genes that regulate cellular growth can
their degradation.
298
teins can alter their activity or promote lead15to uncontrolled
RegulAtioN cellularof
proliferation, a hallmark of cancer.
geNe expRessioN Therefore,
iN BActeRiA
understanding the mechanisms that control gene expression in eukaryotes
is of great interest and may lead to therapies for human diseases.
Coverage of Streptococcus thermophilus CRISPR locus
CRISPR-Cas
302 Repeats
is expanded GTTTTTGTACTCTCAAGATTTAAGTAACTGTACAAC
and Leader
integrated
M16_KLUG8414_10_SE_C16.indd 302 14/09/2018 13:58
in multiple
chapters – Spacer 1 Spacer 3
GAGCTACCAGCTACCCCGTATGTCAGAGAG TAGATTTAATCAGTAATGAGTTAGGCATAA
Chapters 1, 15, (Streptococcus phage 20617) (Streptococcus phage TP-778L)
17, and Special Spacer 2
TTGAATACCAATGCCAGCTTCTTTTAAGGC
Topics Chapters (Streptococcus phage CHPC1151)
ST3 and ST6.
FIGURE 15.13 A cRispR locus from the bacterium Streptococcus thermophilus (lMg18311).
spacer sequences are derived from portions of bacteriophage genomes and are flanked on
either side by a repeat sequence. only 3 of 33 total spacers in this cRispR locus are shown.
P. 298
description of repeated DNA sequences with nonrepetitive genes encode a wide variety of Cas proteins such as DNases,
spacer sequences between them. Since then, CRISPR loci RNases, and proteins of unknown function. The CRISPR-Cas
have been identified in ∙ 50 percent of bacteria species mechanism includes three steps outlined in Figure 15.14.
and in ∙ 90 percent of archaea, another type of prokaryote
1. The first step is known as spacer acquisition. Invading
(Figure 15.13). The spacers remained a mystery until 2005
phage DNA is cleaved into small fragments, which are
when three independent studies demonstrated that CRISPR
directly inserted into the CRISPR locus to become new
spacer sequences were identical to fragments of phage
spacers. The Cas1 nuclease and an associated Cas2 pro-
genomes. This insight led to speculation that viral sequences
tein are required for spacer acquisition. New spacers are
within CRISPR loci serve as a “molecular memory” of previ-
inserted proximal to the leader sequence of the CRISPR
ous viral attacks.
locus, with older spacers being located progressively more
A01_KLUG8414_10_SE_FM.indd 2 Downloaded by: Testbankguides |
The first experimental evidence that CRISPRs are impor- Want to earn $1.236 16/11/18 5:08
distal. When new spacers are added, repeat sequences are
tant for adaptive immunity came from an unexpected place.
Distribution of this document is illegal extra per year?
duplicated such that each spacer is flanked by repeats.
Danisco, a Danish food science company, sought to create a
