Consument Study guides, Class notes & Summaries

Looking for the best study guides, study notes and summaries about Consument? On this page you'll find 390 study documents about Consument.

All 390 results

Sort by

Summary: Consumer and Marketing (MIDTERM 1) Summary: Consumer and Marketing (MIDTERM 1) Popular
  • Summary: Consumer and Marketing (MIDTERM 1)

  • Summary • 22 pages • 2024
  • This is a summary for the first midterm of Consumer & Marketing, covering chapters 1 to 6 of the book: Consumer Behavior, 8th edition. The summary is written in English
    (1)
  • $4.98
  • 5x sold
  • + learn more
MIDTERM 2 Summary: Consumer & Marketing MIDTERM 2 Summary: Consumer & Marketing
  • MIDTERM 2 Summary: Consumer & Marketing

  • Summary • 26 pages • 2024
  • This is a summary for the second midterm of the Consumer & Marketing course. This summary contains chapters 7 to 14 of the book Consumer Behavior (8th edition), which are part of the exam material
    (0)
  • $4.98
  • 3x sold
  • + learn more
MNM2605 Consumer Behaviour - Assignment 4 - MW Motors Case Study
  • MNM2605 Consumer Behaviour - Assignment 4 - MW Motors Case Study

  • Essay • 12 pages • 2022
  • This assignment is about the case study of MW-Motors and how they have adapted their brand to satisfy their expanding consumer base. In this assignment we discuss the process Winnie will go through to make a decision about her purchase as well as establish the different trends that develops in consumer behaviour.
    (1)
  • $9.79
  • 2x sold
  • + learn more
Department of Life and Consumer Sciences Molecular Genetics
  • Department of Life and Consumer Sciences Molecular Genetics

  • Exam (elaborations) • 5 pages • 2022
  • Question 1 [15] Describe and illustrate how you could differentiate between these four DNA strands, using DNA melting experiments: Strand 1: 5ʹATTTTAAATTAGCATTTAAT3ʹ Strand 2: 5ʹATGCCGATATTTTTAGCGCA3ʹ Strand 3: 5ʹAGCGGGGCGGCAGCGCGGAT3ʹ Strand 4: 5ʹAGCGGGGCGGCAGCGCGGATA3ʹ Question 2 [10] Your friend studying computer science is designing a new protein folding tool that will predict protein folding pathways. Explain to them, using your UNISA BCH3703 module content, why a particul...
    (1)
  • $11.99
  • 1x sold
  • + learn more
Consumer Behavior summary
  • Consumer Behavior summary

  • Summary • 71 pages • 2023 Popular
  • An all encompassing summary of the course Consumer Behaviour. Written in an organized, structured way with plenty of clear examples and visuals to guide you through the learning process. This summary includes; * all lectures * all guest lectures * the book Nudge by Thaler and Sunstein * all the required readings (articles, videos, ...) This course is given by Clara Cutello en Barbara Briers at the Faculty of Business and Economics.
    (0)
  • $12.22
  • 3x sold
  • + learn more
Summary Consumer Behaviour Marketing Management Erasmus University
  • Summary Consumer Behaviour Marketing Management Erasmus University

  • Summary • 53 pages • 2023
  • This is an extensive summary of the subject Consumer Behaviour at Rotterdam School of Management. It includes all notes from class and examples. I got an 8.5 with this summary.
    (0)
  • $7.22
  • + learn more
Consumer Behavior Summary, ISBN: 9780357721292. Consumer and Marketing (323623-B-6), Chapter 3. Consumer Behavior Summary, ISBN: 9780357721292. Consumer and Marketing (323623-B-6), Chapter 3.
  • Consumer Behavior Summary, ISBN: 9780357721292. Consumer and Marketing (323623-B-6), Chapter 3.

  • Summary • 8 pages • 2024
  • Available in package deal
  • Summary for the Consumer and Marketing course (323623-B-6). It includes chapter 3 of the Consumer Behavior 8th edition book. Wayne D. Hoyer, Deborah J. MacInnis and Rik Pieters (2024). ISBN: 9780357721292.
    (0)
  • $5.44
  • + learn more
AAFCS 200* - Consumer & Resource Management Questions and Answers 100% AccurateAAFCS 200* - Consumer & Resource Management Questions and Answers 100% Accurate
  • AAFCS 200* - Consumer & Resource Management Questions and Answers 100% AccurateAAFCS 200* - Consumer & Resource Management Questions and Answers 100% Accurate

  • Exam (elaborations) • 10 pages • 2023
  • Available in package deal
  • AAFCS 200* - Consumer & Resource Management Questions and Answers 100% AccurateAAFCS 200* - Consumer & Resource Management Questions and Answers 100% AccurateAAFCS 200* - Consumer & Resource Management Questions and Answers 100% AccurateAAFCS 200* - Consumer & Resource Management Questions and Answers 100% AccuratePensions - ANSWER-are funds paid to retired employees who paid into a pension fund while they were employed. Social Security - ANSWER--A federal program under the direction of the S...
    (0)
  • $10.99
  • + learn more
AAFCS 200* - Consumer & Resource Management Exam with complete solutions
  • AAFCS 200* - Consumer & Resource Management Exam with complete solutions

  • Exam (elaborations) • 10 pages • 2023
  • Available in package deal
  • AAFCS 200* - Consumer & Resource Management Exam with complete solutions
    (0)
  • $11.99
  • + learn more